Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hutC gene

Properties
Regulog: HutC - Moraxellaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/gamma
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acinetobacter baumannii AB0057
Position: -67
Score: 4.48849
Sequence: GTGGTTGTATATACATAGCA
Locus tag: AB57_3862
Name: hutC
Funciton: Histidine utilization repressor, GntR family
Locus tag: AB57_3861
Name: hutD
Funciton: Conserved hypothetical protein related to histidine degradation
hutC-hutD -67 4.5 GTGGTTGTATATACATAGCA AB57_3862