Orthologous regulated operons containing hutC gene
| Regulog: | HutC - Moraxellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acinetobacter baumannii AB0057 | ||||
|
Position: -67
Score: 4.48849 Sequence: GTGGTTGTATATACATAGCA
Locus tag: AB57_3862
Name: hutC Funciton: Histidine utilization repressor, GntR family
Locus tag: AB57_3861
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation |
||||
| hutC-hutD | -67 | 4.5 | GTGGTTGTATATACATAGCA | AB57_3862 |