Orthologous regulated operons containing COG1457 (CodB) gene
| Regulog: | HutC - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -111
Score: 5.87176 Sequence: ATGCTTGTATATACAAGAAC
Locus tag: KPN_01286
Name: COG1457 (CodB) Funciton: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
||||
| COG1457 (CodB) | -111 | 5.9 | ATGCTTGTATATACAAGAAC | KPN_01286 |