Orthologous regulated operons containing hutD gene
| Regulog: | HutC - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Erwinia amylovora ATCC 49946 | ||||
|
Position: -38
Score: 4.59801 Sequence: GTATATGTATATACAACCTC
Locus tag: EAM_1257
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: EAM_1256
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation |
||||
| hutF-hutD | -38 | 4.6 | GTATATGTATATACAACCTC | EAM_1257 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -147
Score: 5.87176 Sequence: GTTCTTGTATATACAAGCAT
Locus tag: KPN_01285
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation |
||||
| hutD | -147 | 5.9 | GTTCTTGTATATACAAGCAT | KPN_01285 |
| Serratia proteamaculans 568 | ||||
|
Position: -117
Score: 5.32729 Sequence: GTATATGTATATACAACTAA
Locus tag: Spro_2079
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: Spro_2080
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation |
||||
| hutF-hutD | -117 | 5.3 | GTATATGTATATACAACTAA | Spro_2079 |
| Yersinia pestis KIM | ||||
|
Position: -33
Score: 5.78482 Sequence: GTATATGTATATACAAGTAA
Locus tag: y2338
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: y2337
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation |
||||
| hutF-hutD | -33 | 5.8 | GTATATGTATATACAAGTAA | y2338 |