Orthologous regulated operons containing COG1732 (OpuBC) gene
| Regulog: | HutC - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -50
Score: 5.98323 Sequence: TGGTTTGTATATACAAGTAA
Locus tag: CKO_02925
Name: COG1732 (OpuBC) Funciton: ABC proline/glycine/betaine transporter, periplasmic binding domain
Locus tag: CKO_02926
Name: hutH2 Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: CKO_02927
Name: COG1174 (OpuBB) Funciton: ABC proline/glycine/betaine transporter, permease component
Locus tag: CKO_02928
Name: COG1174 (OpuBB) Funciton: ABC proline/glycine/betaine transporter, permease component
Locus tag: CKO_02929
Name: COG1125 (OpuBA) Funciton: ABC proline/glycine/betaine transporter, ATPase component
Locus tag: CKO_02930
Name: COG2423 Funciton: Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12)
Locus tag: CKO_02931
Name: COG3221 (PhnD) Funciton: ABC phosphate/phosphonate transporter, periplasmic binding component |
||||
| COG1732 (OpuBC)-hutH2-COG1174 (OpuBB)-COG1174 (OpuBB)-COG1125 (OpuBA)-COG2423-COG3221 (PhnD) | -50 | 6 | TGGTTTGTATATACAAGTAA | CKO_02925 |