Orthologous regulated operons containing hutH2 gene
Regulog: | HutC - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Histidine utilization |
Effector: | cis-Urocanic acid |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Serratia proteamaculans 568 | ||||
Position: -20
Score: 6.28949 Sequence: ATGCTTGTACATACAAGTAT
Locus tag: Spro_0805
Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: Spro_0804
Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Spro_0803
Name: hisT Funciton: Histidine transport protein (permease)
Locus tag: Spro_0802
Name: hutX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
Locus tag: Spro_0801
Name: hutW Funciton: Histidine ABC transporter, permease protein (TC 3.A.1)
Locus tag: Spro_0800
Name: hutV Funciton: Histidine ABC transporter, ATP-binding protein (TC 3.A.1)
Locus tag: Spro_0799
Name: hutH2 Funciton: Histidine ammonia-lyase (EC 4.3.1.3) |
||||
hutU-hutH-hisT-hutX-hutW-hutV-hutH2 | -20 | 6.3 | ATGCTTGTACATACAAGTAT | Spro_0805 |