Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF11086 gene

Properties
Regulog: PhrR - Psychromonadaceae/Aeromonadales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Light-dependent DNA repair
Effector: Adenosylcobalamin; Blue light
Phylum: Proteobacteria/Gamma
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Aeromonas salmonicida subsp. salmonicida A449
Position: -75
Score: 5.85077
Sequence: TATACAGCTTCCATTATTTTGTATA
Position: -18
Score: 6.01495
Sequence: TATACAAGGAGTGCCAACATGTACA
Locus tag: ASA_3232
Name: COG3272
Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: ASA_3231
Name: phrR
Funciton: Transcriptional regulator, MerR family, associated with photolyase
Locus tag: ASA_3230
Name: phr
Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
Locus tag: ASA_3229
Name: PF10184
Funciton: Protein of unknown function DUF2358
Locus tag: ASA_3228
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: ASA_3227
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: ASA_3226
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: ASA_3225
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: ASA_3224
Name: PF11086
Funciton: Protein of unknown function DUF2878
Locus tag: ASA_3223
Name: PF09493
Funciton: Tryptophan-rich protein (DUF2389)
Locus tag: ASA_3222
Name: FIG026291
Funciton: FIG026291: Hypothetical periplasmic protein
Locus tag: ASA_3221
Name: FIG002577
Funciton: FIG002577: Putative lipoprotein precursor
COG3272-phrR-phr-PF10184-PF00106-PF01593-PF07103-PF02353-PF11086-PF09493-FIG026291-FIG002577 -75 5.9 TATACAGCTTCCATTATTTTGTATA ASA_3232
-18 6 TATACAAGGAGTGCCAACATGTACA