Orthologous regulated operons containing FIG026291 gene

Properties
Regulog:	PhrR - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Adenosylcobalamin; Blue light
Phylum:	Proteobacteria/Gamma

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aeromonas salmonicida subsp. salmonicida A449
Position: -75 Score: 5.85077 Sequence: TATACAGCTTCCATTATTTTGTATA Position: -18 Score: 6.01495 Sequence: TATACAAGGAGTGCCAACATGTACA Locus tag: ASA_3232 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: ASA_3231 Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase Locus tag: ASA_3230 Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) Locus tag: ASA_3229 Name: PF10184 Funciton: Protein of unknown function DUF2358 Locus tag: ASA_3228 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: ASA_3227 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: ASA_3226 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: ASA_3225 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: ASA_3224 Name: PF11086 Funciton: Protein of unknown function DUF2878 Locus tag: ASA_3223 Name: PF09493 Funciton: Tryptophan-rich protein (DUF2389) Locus tag: ASA_3222 Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein Locus tag: ASA_3221 Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor
COG3272-phrR-phr-PF10184-PF00106-PF01593-PF07103-PF02353-PF11086-PF09493-FIG026291-FIG002577	-75	5.9	TATACAGCTTCCATTATTTTGTATA	ASA_3232
	-18	6	TATACAAGGAGTGCCAACATGTACA