Orthologous regulated operons containing PF07103 gene
Regulog: | PhrR - Vibrionales |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | repressor |
Biological process: | Light-dependent DNA repair |
Effector: | Heat shock; Adenosylcobalamin |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Vibrio angustum S14 | ||||
Position: -87
Score: 6.15881 Sequence: TATACAATAAAAAAACTTGTACA
Locus tag: VAS14_11844
Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: VAS14_11849
Name: VAS14_11849 Funciton: hypothetical protein
Locus tag: VAS14_11854
Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: VAS14_11859
Name: metY Funciton: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
Locus tag: VAS14_11864
Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase
Locus tag: VAS14_11869
Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
Locus tag: VAS14_11874
Name: PF07366 Funciton: Protein of unknown function DUF1486
Locus tag: VAS14_11879
Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VAS14_11884
Name: PF01593 Funciton: Flavin containing amine oxidoreductase
Locus tag: VAS14_11889
Name: PF07103 Funciton: Protein of unknown function DUF1365
Locus tag: VAS14_11894
Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VAS14_11899
Name: PF11086 Funciton: Protein of unknown function DUF2878 |
||||
COG3272-VAS14_11849-COG3272-metY-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-PF11086 | -87 | 6.2 | TATACAATAAAAAAACTTGTACA | VAS14_11844 |
Vibrio cholerae O1 biovar eltor str. N16961 | ||||
Position: -32
Score: 5.57279 Sequence: TATACGAATCTTAAATTTGTATA
Locus tag: VC1118
Name: PF07366 Funciton: Protein of unknown function DUF1486
Locus tag: VC1119
Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VC1120
Name: PF01593 Funciton: Flavin containing amine oxidoreductase
Locus tag: VC1121
Name: PF07103 Funciton: Protein of unknown function DUF1365
Locus tag: VC1122
Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VC1123
Name: PF11086 Funciton: Protein of unknown function DUF2878
Locus tag: VC1124
Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein
Locus tag: VC1125
Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor |
||||
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577 | -32 | 5.6 | TATACGAATCTTAAATTTGTATA | VC1118 |
Vibrio harveyi ATCC BAA-1116 | ||||
Position: -51
Score: 6.47882 Sequence: TGTACATATAATATTTTTGTACA
Locus tag: VIBHAR_01814
Name: PF07366 Funciton: Protein of unknown function DUF1486
Locus tag: VIBHAR_01815
Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VIBHAR_01816
Name: PF01593 Funciton: Flavin containing amine oxidoreductase
Locus tag: VIBHAR_01817
Name: PF07103 Funciton: Protein of unknown function DUF1365
Locus tag: VIBHAR_01818
Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VIBHAR_01819
Name: PF11086 Funciton: Protein of unknown function DUF2878
Locus tag: VIBHAR_01820
Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein
Locus tag: VIBHAR_01821
Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor |
||||
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577 | -51 | 6.5 | TGTACATATAATATTTTTGTACA | VIBHAR_01814 |
Vibrio parahaemolyticus RIMD 2210633 | ||||
Position: -96
Score: 6.41387 Sequence: TATACAAGTTTTTTTTTTGTACA
Position: -51
Score: 6.33457 Sequence: TGTACATGTAATATTTTTGTACA
Locus tag: VP1119
Name: PF07366 Funciton: Protein of unknown function DUF1486
Locus tag: VP1120
Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VP1121
Name: PF01593 Funciton: Flavin containing amine oxidoreductase
Locus tag: VP1122
Name: PF07103 Funciton: Protein of unknown function DUF1365
Locus tag: VP1123
Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VP1124
Name: PF11086 Funciton: Protein of unknown function DUF2878
Locus tag: VP1125
Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein
Locus tag: VP1126
Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor |
||||
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577 | -96 | 6.4 | TATACAAGTTTTTTTTTTGTACA | VP1119 |
-51 | 6.3 | TGTACATGTAATATTTTTGTACA | ||
Vibrio shilonii AK1 | ||||
Position: -95
Score: 4.60909 Sequence: TATACAAAAAGTTGTACTTTCCA
Locus tag: VSAK1_00115
Name: PF07366 Funciton: Protein of unknown function DUF1486
Locus tag: VSAK1_00120
Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VSAK1_00125
Name: PF01593 Funciton: Flavin containing amine oxidoreductase
Locus tag: VSAK1_00130
Name: PF07103 Funciton: Protein of unknown function DUF1365
Locus tag: VSAK1_00135
Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VSAK1_00140
Name: PF11086 Funciton: Protein of unknown function DUF2878
Locus tag: VSAK1_00145
Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein
Locus tag: VSAK1_00150
Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor |
||||
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577 | -95 | 4.6 | TATACAAAAAGTTGTACTTTCCA | VSAK1_00115 |
Vibrio vulnificus CMCP6 | ||||
Position: -93
Score: 5.54089 Sequence: TATACAAAAAAACAATCGGTATA
Locus tag: VV1_2936
Name: PF07366 Funciton: Protein of unknown function DUF1486
Locus tag: VV1_2935
Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VV1_2934
Name: PF01593 Funciton: Flavin containing amine oxidoreductase
Locus tag: VV1_2933
Name: PF07103 Funciton: Protein of unknown function DUF1365
Locus tag: VV1_2932
Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VV1_2931
Name: PF11086 Funciton: Protein of unknown function DUF2878
Locus tag: VV1_2930
Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein
Locus tag: VV1_2929
Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor |
||||
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577 | -93 | 5.5 | TATACAAAAAAACAATCGGTATA | VV1_2936 |