Orthologous regulated operons containing VAS14_11849 gene
Regulog: | PhrR - Vibrionales |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | repressor |
Biological process: | Light-dependent DNA repair |
Effector: | Heat shock; Adenosylcobalamin |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Vibrio angustum S14 | ||||
Position: -87
Score: 6.15881 Sequence: TATACAATAAAAAAACTTGTACA
Locus tag: VAS14_11844
Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: VAS14_11849
Name: VAS14_11849 Funciton: hypothetical protein
Locus tag: VAS14_11854
Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: VAS14_11859
Name: metY Funciton: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
Locus tag: VAS14_11864
Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase
Locus tag: VAS14_11869
Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
Locus tag: VAS14_11874
Name: PF07366 Funciton: Protein of unknown function DUF1486
Locus tag: VAS14_11879
Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VAS14_11884
Name: PF01593 Funciton: Flavin containing amine oxidoreductase
Locus tag: VAS14_11889
Name: PF07103 Funciton: Protein of unknown function DUF1365
Locus tag: VAS14_11894
Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VAS14_11899
Name: PF11086 Funciton: Protein of unknown function DUF2878 |
||||
COG3272-VAS14_11849-COG3272-metY-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-PF11086 | -87 | 6.2 | TATACAATAAAAAAACTTGTACA | VAS14_11844 |