Orthologous regulated operons containing TM1029 gene
| Regulog: | TM1030 - Thermotogales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Thermotogae |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Thermotoga lettingae TMO | ||||
|
Position: -65
Score: 5.13666 Sequence: TATTGACCACATGGTCAATA
Locus tag: Tlet_1862
Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: Tlet_1861
Name: TM1029 Funciton: Predicted ABC transport system, permease protein
Locus tag: Tlet_1860
Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family |
||||
| TM1028-TM1029-TM1030 | -65 | 5.1 | TATTGACCACATGGTCAATA | Tlet_1862 |
| Thermotoga maritima MSB8 | ||||
|
Position: -34
Score: 7.09261 Sequence: ATTTGACTGACCAGTCAATC
Locus tag: TM1028
Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: TM1029
Name: TM1029 Funciton: Predicted ABC transport system, permease protein
Locus tag: TM1030
Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family |
||||
| TM1028-TM1029-TM1030 | -34 | 7.1 | ATTTGACTGACCAGTCAATC | TM1028 |
| Thermotoga naphthophila RKU-10 | ||||
|
Position: -34
Score: 7.09261 Sequence: ATTTGACTGACCAGTCAATC
Locus tag: Tnap_1736
Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: Tnap_1735
Name: TM1029 Funciton: Predicted ABC transport system, permease protein
Locus tag: Tnap_1734
Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family |
||||
| TM1028-TM1029-TM1030 | -34 | 7.1 | ATTTGACTGACCAGTCAATC | Tnap_1736 |
| Thermotoga neapolitana DSM 4359 | ||||
|
Position: -63
Score: 5.9413 Sequence: GATTGACTCATTAGTCAATT
Locus tag: CTN_1539
Name: CTN_1539 Funciton: ABC transporter related precursor
Locus tag: CTN_1538
Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: CTN_1537
Name: TM1029 Funciton: Predicted ABC transport system, permease protein
Locus tag: CTN_1536
Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family |
||||
| CTN_1539-TM1028-TM1029-TM1030 | -63 | 5.9 | GATTGACTCATTAGTCAATT | CTN_1539 |
| Thermotoga petrophila RKU-1 | ||||
|
Position: -34
Score: 7.09261 Sequence: ATTTGACTGACCAGTCAATC
Locus tag: Tpet_1722
Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: Tpet_1721
Name: TM1029 Funciton: Predicted ABC transport system, permease protein
Locus tag: Tpet_1720
Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family |
||||
| TM1028-TM1029-TM1030 | -34 | 7.1 | ATTTGACTGACCAGTCAATC | Tpet_1722 |
| Thermotoga sp. RQ2 | ||||
|
Position: -34
Score: 7.09261 Sequence: ATTTGACTGACCAGTCAATC
Locus tag: TRQ2_1780
Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: TRQ2_1779
Name: TM1029 Funciton: Predicted ABC transport system, permease protein
Locus tag: TRQ2_1778
Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family |
||||
| TM1028-TM1029-TM1030 | -34 | 7.1 | ATTTGACTGACCAGTCAATC | TRQ2_1780 |