Orthologous regulated operons containing TM1029 gene

Properties
Regulog:	TM1030 - Thermotogales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Phylum:	Thermotogae

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermotoga lettingae TMO
Position: -65 Score: 5.13666 Sequence: TATTGACCACATGGTCAATA Locus tag: Tlet_1862 Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein Locus tag: Tlet_1861 Name: TM1029 Funciton: Predicted ABC transport system, permease protein Locus tag: Tlet_1860 Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family
TM1028-TM1029-TM1030	-65	5.1	TATTGACCACATGGTCAATA	Tlet_1862
Thermotoga maritima MSB8
Position: -34 Score: 7.09261 Sequence: ATTTGACTGACCAGTCAATC Locus tag: TM1028 Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein Locus tag: TM1029 Name: TM1029 Funciton: Predicted ABC transport system, permease protein Locus tag: TM1030 Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family
TM1028-TM1029-TM1030	-34	7.1	ATTTGACTGACCAGTCAATC	TM1028
Thermotoga naphthophila RKU-10
Position: -34 Score: 7.09261 Sequence: ATTTGACTGACCAGTCAATC Locus tag: Tnap_1736 Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein Locus tag: Tnap_1735 Name: TM1029 Funciton: Predicted ABC transport system, permease protein Locus tag: Tnap_1734 Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family
TM1028-TM1029-TM1030	-34	7.1	ATTTGACTGACCAGTCAATC	Tnap_1736
Thermotoga neapolitana DSM 4359
Position: -63 Score: 5.9413 Sequence: GATTGACTCATTAGTCAATT Locus tag: CTN_1539 Name: CTN_1539 Funciton: ABC transporter related precursor Locus tag: CTN_1538 Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein Locus tag: CTN_1537 Name: TM1029 Funciton: Predicted ABC transport system, permease protein Locus tag: CTN_1536 Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family
CTN_1539-TM1028-TM1029-TM1030	-63	5.9	GATTGACTCATTAGTCAATT	CTN_1539
Thermotoga petrophila RKU-1
Position: -34 Score: 7.09261 Sequence: ATTTGACTGACCAGTCAATC Locus tag: Tpet_1722 Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein Locus tag: Tpet_1721 Name: TM1029 Funciton: Predicted ABC transport system, permease protein Locus tag: Tpet_1720 Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family
TM1028-TM1029-TM1030	-34	7.1	ATTTGACTGACCAGTCAATC	Tpet_1722
Thermotoga sp. RQ2
Position: -34 Score: 7.09261 Sequence: ATTTGACTGACCAGTCAATC Locus tag: TRQ2_1780 Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein Locus tag: TRQ2_1779 Name: TM1029 Funciton: Predicted ABC transport system, permease protein Locus tag: TRQ2_1778 Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family
TM1028-TM1029-TM1030	-34	7.1	ATTTGACTGACCAGTCAATC	TRQ2_1780