Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing TM1030 gene

Properties
Regulog: TM1030 - Thermotogales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance
Effector:
Phylum: Thermotogae
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga lettingae TMO
Position: -65
Score: 5.13666
Sequence: TATTGACCACATGGTCAATA
Locus tag: Tlet_1862
Name: TM1028
Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: Tlet_1861
Name: TM1029
Funciton: Predicted ABC transport system, permease protein
Locus tag: Tlet_1860
Name: TM1030
Funciton: Predicted multidrug resistance transcription regulator, TetR family
TM1028-TM1029-TM1030 -65 5.1 TATTGACCACATGGTCAATA Tlet_1862
Thermotoga maritima MSB8
Position: -34
Score: 7.09261
Sequence: ATTTGACTGACCAGTCAATC
Locus tag: TM1028
Name: TM1028
Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: TM1029
Name: TM1029
Funciton: Predicted ABC transport system, permease protein
Locus tag: TM1030
Name: TM1030
Funciton: Predicted multidrug resistance transcription regulator, TetR family
TM1028-TM1029-TM1030 -34 7.1 ATTTGACTGACCAGTCAATC TM1028
Thermotoga naphthophila RKU-10
Position: -34
Score: 7.09261
Sequence: ATTTGACTGACCAGTCAATC
Locus tag: Tnap_1736
Name: TM1028
Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: Tnap_1735
Name: TM1029
Funciton: Predicted ABC transport system, permease protein
Locus tag: Tnap_1734
Name: TM1030
Funciton: Predicted multidrug resistance transcription regulator, TetR family
TM1028-TM1029-TM1030 -34 7.1 ATTTGACTGACCAGTCAATC Tnap_1736
Thermotoga neapolitana DSM 4359
Position: -63
Score: 5.9413
Sequence: GATTGACTCATTAGTCAATT
Locus tag: CTN_1539
Name: CTN_1539
Funciton: ABC transporter related precursor
Locus tag: CTN_1538
Name: TM1028
Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: CTN_1537
Name: TM1029
Funciton: Predicted ABC transport system, permease protein
Locus tag: CTN_1536
Name: TM1030
Funciton: Predicted multidrug resistance transcription regulator, TetR family
CTN_1539-TM1028-TM1029-TM1030 -63 5.9 GATTGACTCATTAGTCAATT CTN_1539
Thermotoga petrophila RKU-1
Position: -34
Score: 7.09261
Sequence: ATTTGACTGACCAGTCAATC
Locus tag: Tpet_1722
Name: TM1028
Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: Tpet_1721
Name: TM1029
Funciton: Predicted ABC transport system, permease protein
Locus tag: Tpet_1720
Name: TM1030
Funciton: Predicted multidrug resistance transcription regulator, TetR family
TM1028-TM1029-TM1030 -34 7.1 ATTTGACTGACCAGTCAATC Tpet_1722
Thermotoga sp. RQ2
Position: -34
Score: 7.09261
Sequence: ATTTGACTGACCAGTCAATC
Locus tag: TRQ2_1780
Name: TM1028
Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: TRQ2_1779
Name: TM1029
Funciton: Predicted ABC transport system, permease protein
Locus tag: TRQ2_1778
Name: TM1030
Funciton: Predicted multidrug resistance transcription regulator, TetR family
TM1028-TM1029-TM1030 -34 7.1 ATTTGACTGACCAGTCAATC TRQ2_1780