Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing CTN_1539 gene

Properties
Regulog: TM1030 - Thermotogales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance
Effector:
Phylum: Thermotogae
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga neapolitana DSM 4359
Position: -63
Score: 5.9413
Sequence: GATTGACTCATTAGTCAATT
Locus tag: CTN_1539
Name: CTN_1539
Funciton: ABC transporter related precursor
Locus tag: CTN_1538
Name: TM1028
Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: CTN_1537
Name: TM1029
Funciton: Predicted ABC transport system, permease protein
Locus tag: CTN_1536
Name: TM1030
Funciton: Predicted multidrug resistance transcription regulator, TetR family
CTN_1539-TM1028-TM1029-TM1030 -63 5.9 GATTGACTCATTAGTCAATT CTN_1539
© 2009-2020 RegPrecise