Orthologous regulated operons containing bglF gene

Properties
Regulog:	BglR - Bifidobacteriaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Actinobacteria

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -68 Score: 5.90826 Sequence: AAATCTAAGCGCTTAAATTG Position: -42 Score: 6.73726 Sequence: CAATCTAAGCGGTTAGATTG Locus tag: BAD_1290 Name: bglE Funciton: Beta-glucosides ABC transporter, substrate-binding protein Locus tag: BAD_1289 Name: bglF Funciton: Beta-glucosides ABC transporter, permease component 1 Locus tag: BAD_1288 Name: bglG Funciton: Beta-glucosides ABC transporter, permease component 2 Locus tag: BAD_1287 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
bglE-bglF-bglG-bglB	-68	5.9	AAATCTAAGCGCTTAAATTG	BAD_1290
	-42	6.7	CAATCTAAGCGGTTAGATTG
Bifidobacterium angulatum DSM 20098
Position: -71 Score: 5.0924 Sequence: CAATCTATGCGCTTAAATAT Position: -45 Score: 6.56763 Sequence: CAGTCTAACCGCTTAGATTG Locus tag: BIFANG_00261 Name: bglE Funciton: Beta-glucosides ABC transporter, substrate-binding protein Locus tag: BIFANG_00260 Name: bglF Funciton: Beta-glucosides ABC transporter, permease component 1 Locus tag: BIFANG_00259 Name: bglG Funciton: Beta-glucosides ABC transporter, permease component 2 Locus tag: BIFANG_00258 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
bglE-bglF-bglG-bglB	-71	5.1	CAATCTATGCGCTTAAATAT	BIFANG_00261
	-45	6.6	CAGTCTAACCGCTTAGATTG
Bifidobacterium breve DSM 20213
Position: -52 Score: 6.44678 Sequence: CAATCTACGCGGTTAGATTG Locus tag: BIFBRE_00248 Name: bglE Funciton: Beta-glucosides ABC transporter, substrate-binding protein Locus tag: BIFBRE_00249 Name: bglF Funciton: Beta-glucosides ABC transporter, permease component 1 Locus tag: BIFBRE_00250 Name: bglG Funciton: Beta-glucosides ABC transporter, permease component 2 Locus tag: BIFBRE_00251 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
bglE-bglF-bglG-bglB	-52	6.4	CAATCTACGCGGTTAGATTG	BIFBRE_00248
Bifidobacterium dentium Bd1
Position: -72 Score: 5.62973 Sequence: CAATCTAAGCGCTTAAATAT Position: -46 Score: 6.56763 Sequence: CAGTCTAACCGCTTAGATTG Locus tag: BDP_0952 Name: bglE Funciton: Beta-glucosides ABC transporter, substrate-binding protein Locus tag: BDP_0951 Name: bglF Funciton: Beta-glucosides ABC transporter, permease component 1 Locus tag: BDP_0950 Name: bglG Funciton: Beta-glucosides ABC transporter, permease component 2 Locus tag: BDP_0949 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
bglE-bglF-bglG-bglB	-72	5.6	CAATCTAAGCGCTTAAATAT	BDP_0952
	-46	6.6	CAGTCTAACCGCTTAGATTG