Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing BDP_1880 gene

Properties
Regulog: Zur - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Built upon 33 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium dentium Bd1
Position: -37
Score: 6.14112
Sequence: TATTGATAATGATTATCATTA
Locus tag: BDP_1883
Name: rpmB2
Funciton: LSU ribosomal protein L28p
Locus tag: BDP_1882
Name: rpmG2
Funciton: LSU ribosomal protein L33p
Locus tag: BDP_1881
Name: rpsN2
Funciton: SSU ribosomal protein S14p
Locus tag: BDP_1879
Name: rpmJ2
Funciton: LSU ribosomal protein L36p
Locus tag: BDP_1880
Name: null
Funciton: hypothetical protein
Locus tag: BDP_1878
Name: zinT
Funciton: Candidate zinc-binding lipoprotein ZinT
rpmB2-rpmG2-rpsN2-rpmJ2-BDP_1880-zinT -37 6.1 TATTGATAATGATTATCATTA BDP_1883