Orthologous regulated operons containing znuA3 gene
| Regulog: | Zur - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Gardnerella vaginalis 409-05 | ||||
|
Position: -117
Score: 5.55319 Sequence: TAATGAGAATCATTATTATTA
Locus tag: HMPREF0424_1241
Name: null Funciton: surface-anchored protein domain protein
Locus tag: HMPREF0424_1240
Name: null Funciton: surface-anchored protein domain protein
Locus tag: HMPREF0424_1239
Name: null Funciton: putative ABC transporter-associated repeat protein
Locus tag: HMPREF0424_1238
Name: znuA3 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: HMPREF0424_1237
Name: znuC3 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: HMPREF0424_1236
Name: znuB3 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| HMPREF0424_1241-HMPREF0424_1240-HMPREF0424_1239-znuA3-znuC3-znuB3 | -117 | 5.6 | TAATGAGAATCATTATTATTA | HMPREF0424_1241 |