Orthologous regulated operons containing BIFANG_01627 gene

Properties
Regulog:	NrtR - Bifidobacteriaceae
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Actinobacteria

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bifidobacterium angulatum DSM 20098
Position: 47 Score: 6.41608 Sequence: TTATGGTCAGTGTGACTATAA Locus tag: BIFANG_01628 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR Locus tag: BIFANG_01627 Name: null Funciton: hypothetical protein Locus tag: BIFANG_01626 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: BIFANG_01625 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: BIFANG_01624 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) Locus tag: BIFANG_01623 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7)
nrtR-BIFANG_01627-nadA-nadB-nadC-sufS	47	6.4	TTATGGTCAGTGTGACTATAA	BIFANG_01628

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --