Orthologous regulated operons containing thiT gene
| Regulog: | ThiR - Sulfolobales |
| Regulator type: | Transcription factor |
| Regulator family: | [Other] |
| Regulation mode: | repressor |
| Biological process: | Thiamine transport; Thiamine biosynthesis |
| Effector: | Thiamine phosphate |
| Phylum: | Crenarchaeota |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Sulfolobus acidocaldarius DSM 639 | ||||
|
Position: -42
Score: 5.25491 Sequence: AATATAACTAACTTTATAAC
Locus tag: Saci_2110
Name: thiT Funciton: Predicted thiamin transporter ThiT |
||||
| thiT | -42 | 5.3 | AATATAACTAACTTTATAAC | Saci_2110 |
| Sulfolobus islandicus Y.N.15.51 | ||||
|
Position: -42
Score: 5.28738 Sequence: AAAATAAGTGACTTTATAAG
Locus tag: YN1551_2514
Name: thiT Funciton: Predicted thiamin transporter ThiT |
||||
| thiT | -42 | 5.3 | AAAATAAGTGACTTTATAAG | YN1551_2514 |
| Sulfolobus solfataricus P2 | ||||
|
Position: -42
Score: 5.28738 Sequence: AAAATAAGTGACTTTATAAG
Locus tag: SSO1593
Name: thiT Funciton: Predicted thiamin transporter ThiT |
||||
| thiT | -42 | 5.3 | AAAATAAGTGACTTTATAAG | SSO1593 |
| Sulfolobus tokodaii str. 7 | ||||
|
Position: -42
Score: 5.57791 Sequence: CATATAAGTAGGTTTATAAG
Locus tag: ST1132
Name: thiT Funciton: Predicted thiamin transporter ThiT |
||||
| thiT | -42 | 5.6 | CATATAAGTAGGTTTATAAG | ST1132 |