Orthologous regulated operons containing Blon_0375 gene
Regulog: | Blon_0374 - Bifidobacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Carbohydrate metabolism |
Effector: | |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bifidobacterium longum subsp. infantis ATCC 15697 | ||||
Position: -106
Score: 6.24679 Sequence: TAGTTTATGCGCATCAACAC
Position: -52
Score: 6.25832 Sequence: TCATTTATGCGCATCAATAT
Position: -36
Score: 4.92428 Sequence: ATATTGAAGCGTATAACTAA
Locus tag: Blon_0375
Name: Blon_0375 Funciton: ABC transporter, sugar-binding component
Locus tag: Blon_0376
Name: Blon_0376 Funciton: ABC transporter, permease component
Locus tag: Blon_0377
Name: Blon_0377 Funciton: ABC transporter, permease component |
||||
Blon_0375-Blon_0376-Blon_0377 | -106 | 6.2 | TAGTTTATGCGCATCAACAC | Blon_0375 |
-52 | 6.3 | TCATTTATGCGCATCAATAT | ||
-36 | 4.9 | ATATTGAAGCGTATAACTAA |