Orthologous regulated operons containing rihT gene

Properties
Regulog:	RbsR2 - Bifidobacteriaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Ribonucleoside utilization
Effector:	Ribose
Phylum:	Actinobacteria

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -102 Score: 5.91868 Sequence: GTGATTTAACGTCTTATCAT Position: -71 Score: 6.22729 Sequence: ATGATGAAACGTTAAATCAT Locus tag: Blon_0638 Name: rihC Funciton: Non-specific ribonucleoside hydrolase (EC 3.2.-.-) Locus tag: Blon_0639 Name: rihT Funciton: Predicted ribonucleoside transporter, MFS family Locus tag: Blon_0640 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
rihC-rihT-rbsK	-102	5.9	GTGATTTAACGTCTTATCAT	Blon_0638
	-71	6.2	ATGATGAAACGTTAAATCAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --