Orthologous regulated operons containing iunT gene
| Regulog: | RbsR3 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Ribonucleoside utilization |
| Effector: | Ribose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium dentium Bd1 | ||||
|
Position: -131
Score: 5.8322 Sequence: TTGCCAAATCGATTTATCTT
Locus tag: BDP_1918
Name: iunT Funciton: Predicted inosine-uridine transporter, MFS family |
||||
| iunT | -131 | 5.8 | TTGCCAAATCGATTTATCTT | BDP_1918 |