Orthologous regulated operons containing iunH gene
| Regulog: | RbsR3 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Ribonucleoside utilization |
| Effector: | Ribose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium dentium Bd1 | ||||
|
Position: -35
Score: 6.28683 Sequence: TTGCCAAATCGATTTATCAA
Locus tag: BDP_1920
Name: iunH Funciton: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1) |
||||
| iunH | -35 | 6.3 | TTGCCAAATCGATTTATCAA | BDP_1920 |
| Bifidobacterium gallicum DSM 20093 | ||||
|
Position: -47
Score: 5.87037 Sequence: TTGCAAAAACGTTTTAGCGA
Locus tag: BIFGAL_01080
Name: iunH Funciton: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1) |
||||
| iunH | -47 | 5.9 | TTGCAAAAACGTTTTAGCGA | BIFGAL_01080 |