Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing zur gene

Properties
Regulog: Zur - Thermotogales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Thermotogae
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Petrotoga mobilis SJ95
Position: -97
Score: 5.77684
Sequence: ATGCTTATGCAAATCAGTTGCAA
Position: -80
Score: 5.79284
Sequence: TTGCAAAAACAAATCGTTTGCAT
Locus tag: Pmob_0990
Name: zur
Funciton: Zinc uptake transcriptional regulator, Fur family
Locus tag: Pmob_0989
Name: znuA
Funciton: Zinc uptake ABC transport system, zinc-binding protein
Locus tag: Pmob_0988
Name: znuC
Funciton: Zinc uptake ABC transport system, ATP-binding protein
Locus tag: Pmob_0987
Name: znuB
Funciton: Zinc uptake ABC transport system, permease protein
zur-znuA-znuC-znuB -97 5.8 ATGCTTATGCAAATCAGTTGCAA Pmob_0990
-80 5.8 TTGCAAAAACAAATCGTTTGCAT
Thermosipho africanus TCF52B
Position: -42
Score: 6.91067
Sequence: ATGCAAATGATTTGCATTTGCAA
Locus tag: THA_725
Name: zur
Funciton: Zinc uptake transcriptional regulator, Fur family
Locus tag: THA_726
Name: znuA
Funciton: Zinc uptake ABC transport system, zinc-binding protein
Locus tag: THA_727
Name: znuC
Funciton: Zinc uptake ABC transport system, ATP-binding protein
Locus tag: THA_728
Name: znuB
Funciton: Zinc uptake ABC transport system, permease protein
zur-znuA-znuC-znuB -42 6.9 ATGCAAATGATTTGCATTTGCAA THA_725
Thermosipho melanesiensis BI429
Position: -37
Score: 6.6698
Sequence: ATGCAAATGATTTGCATTTTCAA
Locus tag: Tmel_0432
Name: zur
Funciton: Zinc uptake transcriptional regulator, Fur family
Locus tag: Tmel_0433
Name: znuA
Funciton: Zinc uptake ABC transport system, zinc-binding protein
Locus tag: Tmel_0434
Name: znuC
Funciton: Zinc uptake ABC transport system, ATP-binding protein
Locus tag: Tmel_0435
Name: znuB
Funciton: Zinc uptake ABC transport system, permease protein
zur-znuA-znuC-znuB -37 6.7 ATGCAAATGATTTGCATTTTCAA Tmel_0432
Thermotoga maritima MSB8
Position: -31
Score: 7.03147
Sequence: TTGCAAATGCTTTGCATTTGCAG
Locus tag: TM0122
Name: zur
Funciton: Zinc uptake transcriptional regulator, Fur family
Locus tag: TM0123
Name: znuA
Funciton: Zinc uptake ABC transport system, zinc-binding protein
Locus tag: TM0124
Name: znuC
Funciton: Zinc uptake ABC transport system, ATP-binding protein
Locus tag: TM0125
Name: znuB
Funciton: Zinc uptake ABC transport system, permease protein
Locus tag: TM0126
Name: znuR
Funciton: predicted zinc uptake two-component system response regulator, OmpR family
Locus tag: TM0127
Name: znuS
Funciton: predicted zinc uptake two-component system histidine kinase
zur-znuA-znuC-znuB-znuR-znuS -31 7 TTGCAAATGCTTTGCATTTGCAG TM0122
Thermotoga naphthophila RKU-10
Position: -31
Score: 7.03147
Sequence: TTGCAAATGCTTTGCATTTGCAG
Locus tag: Tnap_0752
Name: zur
Funciton: Zinc uptake transcriptional regulator, Fur family
Locus tag: Tnap_0753
Name: znuA
Funciton: Zinc uptake ABC transport system, zinc-binding protein
Locus tag: Tnap_0754
Name: znuC
Funciton: Zinc uptake ABC transport system, ATP-binding protein
Locus tag: Tnap_0755
Name: znuB
Funciton: Zinc uptake ABC transport system, permease protein
Locus tag: Tnap_0756
Name: znuR
Funciton: predicted zinc uptake two-component system response regulator, OmpR family
Locus tag: Tnap_0757
Name: znuS
Funciton: predicted zinc uptake two-component system histidine kinase
zur-znuA-znuC-znuB-znuR-znuS -31 7 TTGCAAATGCTTTGCATTTGCAG Tnap_0752
Thermotoga neapolitana DSM 4359
Position: -31
Score: 7.03147
Sequence: TTGCAAATGCTTTGCATTTGCAG
Locus tag: CTN_0567
Name: zur
Funciton: Zinc uptake transcriptional regulator, Fur family
Locus tag: CTN_0566
Name: znuA
Funciton: Zinc uptake ABC transport system, zinc-binding protein
Locus tag: CTN_0565
Name: znuC
Funciton: Zinc uptake ABC transport system, ATP-binding protein
Locus tag: CTN_0564
Name: znuB
Funciton: Zinc uptake ABC transport system, permease protein
Locus tag: CTN_0563
Name: znuR
Funciton: predicted zinc uptake two-component system response regulator, OmpR family
Locus tag: CTN_0562
Name: znuS
Funciton: predicted zinc uptake two-component system histidine kinase
zur-znuA-znuC-znuB-znuR-znuS -31 7 TTGCAAATGCTTTGCATTTGCAG CTN_0567
Thermotoga petrophila RKU-1
Position: -31
Score: 7.03147
Sequence: TTGCAAATGCTTTGCATTTGCAG
Locus tag: Tpet_0802
Name: zur
Funciton: Zinc uptake transcriptional regulator, Fur family
Locus tag: Tpet_0801
Name: znuA
Funciton: Zinc uptake ABC transport system, zinc-binding protein
Locus tag: Tpet_0800
Name: znuC
Funciton: Zinc uptake ABC transport system, ATP-binding protein
Locus tag: Tpet_0799
Name: znuB
Funciton: Zinc uptake ABC transport system, permease protein
Locus tag: Tpet_0798
Name: znuR
Funciton: predicted zinc uptake two-component system response regulator, OmpR family
Locus tag: Tpet_0797
Name: znuS
Funciton: predicted zinc uptake two-component system histidine kinase
zur-znuA-znuC-znuB-znuR-znuS -31 7 TTGCAAATGCTTTGCATTTGCAG Tpet_0802
Thermotoga sp. RQ2
Position: -31
Score: 7.03147
Sequence: TTGCAAATGCTTTGCATTTGCAG
Locus tag: TRQ2_0825
Name: zur
Funciton: Zinc uptake transcriptional regulator, Fur family
Locus tag: TRQ2_0824
Name: znuA
Funciton: Zinc uptake ABC transport system, zinc-binding protein
Locus tag: TRQ2_0823
Name: znuC
Funciton: Zinc uptake ABC transport system, ATP-binding protein
Locus tag: TRQ2_0822
Name: znuB
Funciton: Zinc uptake ABC transport system, permease protein
Locus tag: TRQ2_0821
Name: znuR
Funciton: predicted zinc uptake two-component system response regulator, OmpR family
Locus tag: TRQ2_0820
Name: znuS
Funciton: predicted zinc uptake two-component system histidine kinase
zur-znuA-znuC-znuB-znuR-znuS -31 7 TTGCAAATGCTTTGCATTTGCAG TRQ2_0825
© 2009-2020 RegPrecise