Orthologous regulated operons containing BDP_2108 gene
| Regulog: | BDP_2111 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium dentium Bd1 | ||||
|
Position: -265
Score: 6.16393 Sequence: AAATCGAATCGTTGCGATTA
Position: -145
Score: 5.73676 Sequence: TAATCGAATCGTTGCGATTC
Locus tag: BDP_2110
Name: BDP_2110 Funciton: ABC-type transport system, substrate-binding protein
Locus tag: BDP_2109
Name: BDP_2109 Funciton: ABC-type transport system, permease component
Locus tag: BDP_2108
Name: BDP_2108 Funciton: ABC-type transport system, permease component
Locus tag: BDP_2107
Name: BDP_2107 Funciton: Glycoside hydrolase family 43
Locus tag: BDP_2106
Name: BDP_2106 Funciton: Glycosyl hydrolase family 43 |
||||
| BDP_2110-BDP_2109-BDP_2108-BDP_2107-BDP_2106 | -265 | 6.2 | AAATCGAATCGTTGCGATTA | BDP_2110 |
| -145 | 5.7 | TAATCGAATCGTTGCGATTC | ||