Orthologous regulated operons containing msmG1 gene

Properties
Regulog:	MsmR1 - Bifidobacteriaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Alpha-galactosides utilization
Effector:	Alpha-galactosides
Phylum:	Actinobacteria

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bifidobacterium dentium Bd1
Position: -155 Score: 5.18256 Sequence: ACGTGAAAACGTTATCGAAG Position: -55 Score: 5.43079 Sequence: GCTTGATAACGTTATCGGGT Locus tag: BDP_0487 Name: agaL1 Funciton: Alpha-galactosidase 1 (EC:3.2.1.22) Locus tag: BDP_0488 Name: msmE1 Funciton: Multiple sugar ABC transporter, substrate-binding protein Locus tag: BDP_0489 Name: msmF1 Funciton: Multiple sugar ABC transporter, membrane-spanning permease 1 Locus tag: BDP_0491 Name: msmG1 Funciton: Multiple sugar ABC transporter, membrane-spanning permease 2 Locus tag: BDP_0492 Name: msmR1 Funciton: Transcriptional regulator of alpha-galactoside utilization, LacI family
agaL1-msmE1-msmF1-msmG1-msmR1	-155	5.2	ACGTGAAAACGTTATCGAAG	BDP_0487
	-55	5.4	GCTTGATAACGTTATCGGGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --