Orthologous regulated operons containing msmE1 gene
| Regulog: | MsmR1 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Alpha-galactosides utilization |
| Effector: | Alpha-galactosides |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium dentium Bd1 | ||||
|
Position: -155
Score: 5.18256 Sequence: ACGTGAAAACGTTATCGAAG
Position: -55
Score: 5.43079 Sequence: GCTTGATAACGTTATCGGGT
Locus tag: BDP_0487
Name: agaL1 Funciton: Alpha-galactosidase 1 (EC:3.2.1.22)
Locus tag: BDP_0488
Name: msmE1 Funciton: Multiple sugar ABC transporter, substrate-binding protein
Locus tag: BDP_0489
Name: msmF1 Funciton: Multiple sugar ABC transporter, membrane-spanning permease 1
Locus tag: BDP_0491
Name: msmG1 Funciton: Multiple sugar ABC transporter, membrane-spanning permease 2
Locus tag: BDP_0492
Name: msmR1 Funciton: Transcriptional regulator of alpha-galactoside utilization, LacI family |
||||
| agaL1-msmE1-msmF1-msmG1-msmR1 | -155 | 5.2 | ACGTGAAAACGTTATCGAAG | BDP_0487 |
| -55 | 5.4 | GCTTGATAACGTTATCGGGT | ||