Orthologous regulated operons containing aouT gene
| Regulog: | AouR - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Arabinose oligosaccharide utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium animalis subsp. lactis AD011 | ||||
|
Position: -113
Score: 5.30584 Sequence: GGAAGGAAATATTTCCCAAC
Locus tag: BLA_1513
Name: hypBA1 Funciton: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185)
Locus tag: BLA_1512
Name: aouT Funciton: Arabinose oligosaccharide permease |
||||
| hypBA1-aouT | -113 | 5.3 | GGAAGGAAATATTTCCCAAC | BLA_1513 |