Orthologous regulated operons containing aouB gene
| Regulog: | AouR - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Arabinose oligosaccharide utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium dentium Bd1 | ||||
|
Position: -274
Score: 4.62708 Sequence: ATATGAAACAGTTTTCGCAT
Position: -152
Score: 4.22024 Sequence: TGATGAAATGATTTTGAAAA
Locus tag: BDP_1706
Name: aouA Funciton: Arabinose oligosaccharide ABC transporter, sugar-binding protein
Locus tag: BDP_1705
Name: aouB Funciton: Arabinose oligosaccharide ABC transporter, permease protein 1
Locus tag: BDP_1704
Name: aouC Funciton: Arabinose oligosaccharide ABC transporter, permease component 2
Locus tag: BDP_1703
Name: hypBA1 Funciton: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185) |
||||
| aouA-aouB-aouC-hypBA1 | -274 | 4.6 | ATATGAAACAGTTTTCGCAT | BDP_1706 |
| -152 | 4.2 | TGATGAAATGATTTTGAAAA | ||
| Bifidobacterium longum NCC2705 | ||||
|
Position: -381
Score: 4.41337 Sequence: ATGCGAAAACTTTCGCAAAC
Position: -153
Score: 3.7964 Sequence: TTTTGCAAAAACTTCCATGT
Locus tag: BL0425
Name: aouA Funciton: Arabinose oligosaccharide ABC transporter, sugar-binding protein
Locus tag: BL0424
Name: aouB Funciton: Arabinose oligosaccharide ABC transporter, permease protein 1
Locus tag: BL0423
Name: aouC Funciton: Arabinose oligosaccharide ABC transporter, permease component 2
Locus tag: BL0422
Name: hypBA1 Funciton: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185) |
||||
| aouA-aouB-aouC-hypBA1 | -381 | 4.4 | ATGCGAAAACTTTCGCAAAC | BL0425 |
| -153 | 3.8 | TTTTGCAAAAACTTCCATGT | ||