Orthologous regulated operons containing aouA gene

Properties
Regulog:	AouR - Bifidobacteriaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Arabinose oligosaccharide utilization
Effector:
Phylum:	Actinobacteria

Built upon 11 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bifidobacterium dentium Bd1
Position: -274 Score: 4.62708 Sequence: ATATGAAACAGTTTTCGCAT Position: -152 Score: 4.22024 Sequence: TGATGAAATGATTTTGAAAA Locus tag: BDP_1706 Name: aouA Funciton: Arabinose oligosaccharide ABC transporter, sugar-binding protein Locus tag: BDP_1705 Name: aouB Funciton: Arabinose oligosaccharide ABC transporter, permease protein 1 Locus tag: BDP_1704 Name: aouC Funciton: Arabinose oligosaccharide ABC transporter, permease component 2 Locus tag: BDP_1703 Name: hypBA1 Funciton: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185)
aouA-aouB-aouC-hypBA1	-274	4.6	ATATGAAACAGTTTTCGCAT	BDP_1706
	-152	4.2	TGATGAAATGATTTTGAAAA
Bifidobacterium longum NCC2705
Position: -381 Score: 4.41337 Sequence: ATGCGAAAACTTTCGCAAAC Position: -153 Score: 3.7964 Sequence: TTTTGCAAAAACTTCCATGT Locus tag: BL0425 Name: aouA Funciton: Arabinose oligosaccharide ABC transporter, sugar-binding protein Locus tag: BL0424 Name: aouB Funciton: Arabinose oligosaccharide ABC transporter, permease protein 1 Locus tag: BL0423 Name: aouC Funciton: Arabinose oligosaccharide ABC transporter, permease component 2 Locus tag: BL0422 Name: hypBA1 Funciton: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185)
aouA-aouB-aouC-hypBA1	-381	4.4	ATGCGAAAACTTTCGCAAAC	BL0425
	-153	3.8	TTTTGCAAAAACTTCCATGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --