Orthologous regulated operons containing nanF gene
| Regulog: | NanR - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Sialic acid utilization |
| Effector: | Sialic acid |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium breve DSM 20213 | ||||
|
Position: -149
Score: 5.51163 Sequence: ATAAGTTGTCTGATGTCTTAA
Position: -42
Score: 5.83195 Sequence: ATCAGACATCAGATGTCATAT
Locus tag: BIFBRE_01954
Name: nanB Funciton: Predicted sialic acid ABC transporter, solute binding component
Locus tag: BIFBRE_01955
Name: nanC Funciton: Predicted sialic acid ABC transporter, permease component
Locus tag: BIFBRE_01956
Name: nanD Funciton: Predicted sialic acid ABC transporter, permease component and ATP-binding component
Locus tag: BIFBRE_01957
Name: nanF Funciton: Predicted sialic acid ABC transporter, ATP binding component
Locus tag: BIFBRE_01958
Name: nanA Funciton: N-acetylneuraminate lyase (EC 2.5.1.56)
Locus tag: BIFBRE_01959
Name: nagB2 Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) |
||||
| nanB-nanC-nanD-nanF-nanA-nagB2 | -149 | 5.5 | ATAAGTTGTCTGATGTCTTAA | BIFBRE_01954 |
| -42 | 5.8 | ATCAGACATCAGATGTCATAT | ||
| Bifidobacterium gallicum DSM 20093 | ||||
|
Position: -12
Score: 6.18943 Sequence: ATCAGACATCTGATGTCTTAC
Locus tag: BIFGAL_00396
Name: nanB Funciton: Predicted sialic acid ABC transporter, solute binding component
Locus tag: BIFGAL_00395
Name: nanC Funciton: Predicted sialic acid ABC transporter, permease component
Locus tag: BIFGAL_00394
Name: nanD Funciton: Predicted sialic acid ABC transporter, permease component and ATP-binding component
Locus tag: BIFGAL_00393
Name: nanF Funciton: Predicted sialic acid ABC transporter, ATP binding component
Locus tag: BIFGAL_00392
Name: nanA Funciton: N-acetylneuraminate lyase (EC 2.5.1.56) |
||||
| nanB-nanC-nanD-nanF-nanA | -12 | 6.2 | ATCAGACATCTGATGTCTTAC | BIFGAL_00396 |
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||||
|
Position: -250
Score: 4.89816 Sequence: GGGAAACATCAGACGTCTGAT
Position: -152
Score: 6.58557 Sequence: ATAAGACGTCAGACGTCTTAT
Locus tag: Blon_0647
Name: nanB Funciton: Predicted sialic acid ABC transporter, solute binding component
Locus tag: Blon_0648
Name: nanC Funciton: Predicted sialic acid ABC transporter, permease component
Locus tag: Blon_0649
Name: nanD Funciton: Predicted sialic acid ABC transporter, permease component and ATP-binding component
Locus tag: Blon_0650
Name: nanF Funciton: Predicted sialic acid ABC transporter, ATP binding component
Locus tag: Blon_0651
Name: nanA Funciton: N-acetylneuraminate lyase (EC 2.5.1.56) |
||||
| nanB-nanC-nanD-nanF-nanA | -250 | 4.9 | GGGAAACATCAGACGTCTGAT | Blon_0647 |
| -152 | 6.6 | ATAAGACGTCAGACGTCTTAT | ||