Orthologous regulated operons containing DIP0330 gene
| Regulog: | NanR - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Sialic acid utilization |
| Effector: | N-acetylneuraminic acid |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium diphtheriae NCTC 13129 | ||||
|
Position: -29
Score: 6.09059 Sequence: TCCAGACGTCAGACGTCTGAT
Locus tag: DIP0330
Name: DIP0330 Funciton: Sialidase (EC 3.2.1.18) |
||||
| DIP0330 | -29 | 6.1 | TCCAGACGTCAGACGTCTGAT | DIP0330 |