Orthologous regulated operons containing nanI gene
| Regulog: | NanR - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Sialic acid utilization |
| Effector: | N-acetylneuraminic acid |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium kroppenstedtii DSM 44385 | ||||
|
Position: -156
Score: 6.13645 Sequence: ATCAGACATCAGACATCTGAC
Position: -149
Score: 5.55062 Sequence: ATCAGACATCTGACATGTGGT
Locus tag: ckrop_1872
Name: nanI Funciton: exo-alpha-sialidase |
||||
| nanI | -156 | 6.1 | ATCAGACATCAGACATCTGAC | ckrop_1872 |
| -149 | 5.6 | ATCAGACATCTGACATGTGGT | ||