Orthologous regulated operons containing nanX gene
| Regulog: | NanR - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Sialic acid utilization |
| Effector: | N-acetylneuraminic acid |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -196
Score: 5.40961 Sequence: ATCAGACATCAGACGTTTAGG
Locus tag: cg2936
Name: nanR Funciton: Sialic acid utilization transcriptional regulator NanR, GntR family
Locus tag: cg2935
Name: nanX Funciton: Neuraminidase |
||||
| nanR-nanX | -196 | 5.4 | ATCAGACATCAGACGTTTAGG | cg2936 |