Orthologous regulated operons containing hex gene
| Regulog: | NanR - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Sialic acid utilization |
| Effector: | N-acetylneuraminic acid |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -54
Score: 5.68302 Sequence: ATAAGACATCATACGTCCTAT
Locus tag: cg2929
Name: nagA Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
Locus tag: cg2928
Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Locus tag: cg2927
Name: hex Funciton: Predicted hexosaminidase (EC 3.2.1.52) |
||||
| nagA-nagB-hex | -54 | 5.7 | ATAAGACATCATACGTCCTAT | cg2929 |