Orthologous regulated operons containing nanR gene
| Regulog: | NanR - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Sialic acid utilization |
| Effector: | N-acetylneuraminic acid |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium aurimucosum ATCC 700975 | ||||
|
Position: -159
Score: 5.63886 Sequence: AGAATACATCAGACGTCTGAT
Position: -152
Score: 6.01183 Sequence: ATCAGACGTCTGATGTGTGAA
Locus tag: cauri_0611
Name: nanR Funciton: Sialic acid utilization transcriptional regulator NanR, GntR family |
||||
| nanR | -159 | 5.6 | AGAATACATCAGACGTCTGAT | cauri_0611 |
| -152 | 6 | ATCAGACGTCTGATGTGTGAA | ||
| Corynebacterium diphtheriae NCTC 13129 | ||||
|
Position: -36
Score: 5.96153 Sequence: ATCCTACATCAGACGTCTGAT
Position: -29
Score: 5.43699 Sequence: ATCAGACGTCTGATGTCGGGG
Locus tag: DIP0516
Name: null Funciton: Doubtful CDS. No significant database matches
Locus tag: DIP0517
Name: nanR Funciton: Sialic acid utilization transcriptional regulator NanR, GntR family
Locus tag: DIP0518
Name: nanK Funciton: N-acetylmannosamine kinase (EC 2.7.1.60)
Locus tag: DIP0519
Name: nanE Funciton: N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9)
Locus tag: DIP0520
Name: nagA Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
Locus tag: DIP0521
Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) |
||||
| DIP0516-nanR-nanK-nanE-nagA-nagB | -36 | 6 | ATCCTACATCAGACGTCTGAT | DIP0516 |
| -29 | 5.4 | ATCAGACGTCTGATGTCGGGG | ||
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -196
Score: 5.40961 Sequence: ATCAGACATCAGACGTTTAGG
Locus tag: cg2936
Name: nanR Funciton: Sialic acid utilization transcriptional regulator NanR, GntR family
Locus tag: cg2935
Name: nanX Funciton: Neuraminidase |
||||
| nanR-nanX | -196 | 5.4 | ATCAGACATCAGACGTTTAGG | cg2936 |