Orthologous regulated operons containing bgaY gene

Properties
Regulog:	BgaR - Bifidobacteriaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Phylum:	Actinobacteria

Built upon 22 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bifidobacterium animalis subsp. lactis AD011
Position: -191 Score: 5.16992 Sequence: AACTGTTTGCGCAATCATGC Position: -114 Score: 5.89582 Sequence: CTATGTTTGCGTAAACATTC Locus tag: BLA_0464 Name: bgaY Funciton: Putative beta-galactoside ABC transport system, permease component 2 Locus tag: BLA_0463 Name: bgaZ Funciton: Putative beta-galactoside ABC transport system, permease component 1 Locus tag: BLA_0462 Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23)
bgaY-bgaZ-bgaB	-191	5.2	AACTGTTTGCGCAATCATGC	BLA_0464
	-114	5.9	CTATGTTTGCGTAAACATTC
Bifidobacterium dentium Bd1
Position: -270 Score: 5.09794 Sequence: TAATGTTTTCGTCATCATAG Position: -179 Score: 5.52128 Sequence: TTCTGATAACGTAAACATTT Locus tag: BDP_0655 Name: bgaY Funciton: Putative beta-galactoside ABC transport system, permease component 2 Locus tag: BDP_0656 Name: bgaZ Funciton: Putative beta-galactoside ABC transport system, permease component 1 Locus tag: BDP_0657 Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23)
bgaY-bgaZ-bgaB	-270	5.1	TAATGTTTTCGTCATCATAG	BDP_0655
	-179	5.5	TTCTGATAACGTAAACATTT
Bifidobacterium longum NCC2705
Position: -44 Score: 5.83258 Sequence: TGATGATAACGCAAACATTT Locus tag: BL1170 Name: bgaY Funciton: Putative beta-galactoside ABC transport system, permease component 2 Locus tag: BL1169 Name: bgaZ Funciton: Putative beta-galactoside ABC transport system, permease component 1 Locus tag: BL1168 Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23)
bgaY-bgaZ-bgaB	-44	5.8	TGATGATAACGCAAACATTT	BL1170