Orthologous regulated operons containing Dbac_3055 gene
| Regulog: | DVU0030 - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/MocR |
| Regulation mode: | |
| Biological process: | Amino acid transport |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfomicrobium baculatum DSM 4028 | ||||
|
Position: -64
Score: 4.35463 Sequence: CGCAAACTGTATCTGTACCGC
Locus tag: Dbac_3053
Name: null Funciton: Branched-chain amino acid transport protein azlC
Locus tag: Dbac_3054
Name: null Funciton: Branched-chain amino acid transport protein azlD
Locus tag: Dbac_3055
Name: null Funciton: putative aminotransferase |
||||
| Dbac_3053-Dbac_3054-Dbac_3055 | -64 | 4.4 | CGCAAACTGTATCTGTACCGC | Dbac_3053 |