Orthologous regulated operons containing MSMEG_3267 gene

Properties
Regulog:	MSMEG_3264 - Mycobacteriaceae
Regulator type:	Transcription factor
Regulator family:	DeoR
Regulation mode:
Biological process:	Erythritol utilization; D-threitol utilization
Effector:
Phylum:	Actinobacteria

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Mycobacterium smegmatis str. MC2 155
Position: -74 Score: 7.63115 Sequence: TGAACAGATGTTCTGGACAATTGTGCA Locus tag: MSMEG_3265 Name: MSMEG_3265 Funciton: homolog of sorbitol dehydrogenase Locus tag: MSMEG_3266 Name: MSMEG_3266 Funciton: Predicted erythritol ABC transporter 1, substrate-binding component Locus tag: MSMEG_3267 Name: MSMEG_3267 Funciton: Predicted erythritol ABC transporter, permease protein Locus tag: MSMEG_3268 Name: MSMEG_3268 Funciton: Predicted erythritol ABC transporter, permease protein Locus tag: MSMEG_3269 Name: MSMEG_3269 Funciton: Predicted erythritol ABC transporter 1, ATP-binding protein Locus tag: MSMEG_3270 Name: MSMEG_3270 Funciton: Predicted erythritol ABC transporter 1, ATP-binding protein Locus tag: MSMEG_3271 Name: MSMEG_3271 Funciton: D-erythrulose kinase Locus tag: MSMEG_3272 Name: MSMEG_3272 Funciton: D-erythrulose 4-phosphate isomerase
MSMEG_3265-MSMEG_3266-MSMEG_3267-MSMEG_3268-MSMEG_3269-MSMEG_3270-MSMEG_3271-MSMEG_3272	-74	7.6	TGAACAGATGTTCTGGACAATTGTGCA	MSMEG_3265
Mycobacterium sp. JLS
Position: -71 Score: 7.98138 Sequence: TGAACAGATGTTCTGGACAGATGTGCA Locus tag: Mjls_2593 Name: MSMEG_3265 Funciton: homolog of sorbitol dehydrogenase Locus tag: Mjls_2594 Name: MSMEG_3266 Funciton: Predicted erythritol ABC transporter 1, substrate-binding component Locus tag: Mjls_2595 Name: MSMEG_3267 Funciton: Predicted erythritol ABC transporter, permease protein Locus tag: Mjls_2596 Name: MSMEG_3268 Funciton: Predicted erythritol ABC transporter, permease protein Locus tag: Mjls_2597 Name: MSMEG_3269 Funciton: Predicted erythritol ABC transporter 1, ATP-binding protein Locus tag: Mjls_2598 Name: MSMEG_3270 Funciton: Predicted erythritol ABC transporter 1, ATP-binding protein Locus tag: Mjls_2599 Name: MSMEG_3271 Funciton: D-erythrulose kinase Locus tag: Mjls_2600 Name: MSMEG_3272 Funciton: D-erythrulose 4-phosphate isomerase
MSMEG_3265-MSMEG_3266-MSMEG_3267-MSMEG_3268-MSMEG_3269-MSMEG_3270-MSMEG_3271-MSMEG_3272	-71	8	TGAACAGATGTTCTGGACAGATGTGCA	Mjls_2593