Orthologous regulated operons containing talR gene
| Regulog: | TalR - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | L-talarate utilization |
| Effector: | L-talarate |
| Phylum: | Proteobacteria/Beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Ralstonia eutropha JMP134 | ||||
|
Position: -201
Score: 6.73733 Sequence: TAATGATAACGTTATCATTT
Position: -81
Score: 6.33797 Sequence: AAATGCTAACGTTGTCATTC
Locus tag: Reut_B4642
Name: talR Funciton: Predicted L-talarate-specific transcriptional regulator, LacI family |
||||
| talR | -201 | 6.7 | TAATGATAACGTTATCATTT | Reut_B4642 |
| -81 | 6.3 | AAATGCTAACGTTGTCATTC | ||