Orthologous regulated operons containing talD gene
| Regulog: | TalR - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | L-talarate utilization |
| Effector: | L-talarate |
| Phylum: | Proteobacteria/Beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Ralstonia eutropha JMP134 | ||||
|
Position: -85
Score: 6.33797 Sequence: GAATGACAACGTTAGCATTT
Position: 35
Score: 6.73733 Sequence: AAATGATAACGTTATCATTA
Locus tag: Reut_B4643
Name: talD Funciton: L-talarate dehydratase (EC 4.2.1.-)
Locus tag: Reut_B4644
Name: tctC Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for L-talarate |
||||
| talD-tctC | -85 | 6.3 | GAATGACAACGTTAGCATTT | Reut_B4643 |
| 35 | 6.7 | AAATGATAACGTTATCATTA | ||