Orthologous regulated operons containing talD gene
| Regulog: | TalR - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | L-talarate utilization |
| Effector: | L-talarate |
| Phylum: | Proteobacteria/Beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Delftia acidovorans SPH-1 | ||||
|
Position: -117
Score: 6.99211 Sequence: AAATGACAACGATATCATTT
Position: -37
Score: 6.82001 Sequence: AAATGACAACGATGTCATTC
Locus tag: Daci_4289
Name: tctC Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for L-talarate
Locus tag: Daci_4290
Name: talD Funciton: L-talarate dehydratase (EC 4.2.1.-) |
||||
| tctC-talD | -117 | 7 | AAATGACAACGATATCATTT | Daci_4289 |
| -37 | 6.8 | AAATGACAACGATGTCATTC | ||
| Polaromonas sp. JS666 | ||||
|
Position: -281
Score: 6.78949 Sequence: AAATGACAACGTTATCATTA
Position: -159
Score: 7.04689 Sequence: AAATGATAACGTTATCATTT
Locus tag: Bpro_0435
Name: talD Funciton: L-talarate dehydratase (EC 4.2.1.-)
Locus tag: Bpro_0434
Name: tctC Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for L-talarate |
||||
| talD-tctC | -281 | 6.8 | AAATGACAACGTTATCATTA | Bpro_0435 |
| -159 | 7 | AAATGATAACGTTATCATTT | ||