Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing tctB_Gar gene

Properties
Regulog: GarR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Galactarate utilization
Effector: Galactarate
Phylum: Firmicutes
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus clausii KSM-K16
Position: -42
Score: 6.27438
Sequence: TGTGATATATCAGATTTCATA
Locus tag: ABC3016
Name: garR
Funciton: Predicted transcriptional regulator for galactarate utilization, GntR family
Locus tag: ABC3015
Name: kdgD
Funciton: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
Locus tag: ABC3014
Name: kgsD
Funciton: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26) # in D-glucarate/D-galactarate catabolism
Locus tag: ABC3013
Name: garD2
Funciton: D-galactarate dehydratase (EC 4.2.1.42), alternative enzyme
Locus tag: ABC3012
Name: tctC_Gar
Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for galactarate
Locus tag: ABC3011
Name: tctB_Gar
Funciton: Tripartite tricarboxylate transporter family small permease component, putative transporter for galactarate
Locus tag: ABC3010
Name: tctA_Gar
Funciton: Tripartite tricarboxylate transporter family large permease component, putative transporter for galactarate
garR-kdgD-kgsD-garD2-tctC_Gar-tctB_Gar-tctA_Gar -42 6.3 TGTGATATATCAGATTTCATA ABC3016