Orthologous regulated operons containing BDP_0114 gene
Regulog: | ScrR - Bifidobacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Sucrose utilization |
Effector: | Sucrose |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bifidobacterium dentium Bd1 | ||||
Position: -147
Score: 6.25823 Sequence: TTATCGAACCGGTTTGACAG
Locus tag: BDP_0112
Name: null Funciton: sugar ABC uptake system, solute-binding protein
Locus tag: BDP_0113
Name: null Funciton: sugar ABC transport system, permease component
Locus tag: BDP_0114
Name: null Funciton: sugar ABC uptake system, permease component |
||||
BDP_0112-BDP_0113-BDP_0114 | -147 | 6.3 | TTATCGAACCGGTTTGACAG | BDP_0112 |