Orthologous regulated operons containing BDP_0111 gene
| Regulog: | ScrR - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium dentium Bd1 | ||||
|
Position: -205
Score: 6.25823 Sequence: CTGTCAAACCGGTTCGATAA
Locus tag: BDP_0111
Name: null Funciton: oligo-1,6-glucosidase |
||||
| BDP_0111 | -205 | 6.3 | CTGTCAAACCGGTTCGATAA | BDP_0111 |