Orthologous regulated operons containing smoK gene
| Regulog: | SmoR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sorbitol utilization; Mannitol utilization |
| Effector: | Mannitol; Sorbitol |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -285
Score: 5.20743 Sequence: AACAATACATGCGTAAATTT
Position: -98
Score: 6.03487 Sequence: ATATTGACGCGCGTAAACTT
Locus tag: Atu3166
Name: fruK Funciton: Fructokinase (EC 2.7.1.4)
Locus tag: Atu3167
Name: agaZ Funciton: Tagatose 6-phosphate kinase
Locus tag: Atu3168
Name: null Funciton: ABC transporter, membrane spanning protein (sorbitol/mannitol)
Locus tag: Atu3169
Name: null Funciton: ABC transporter, membrane spanning protein (sorbitol/mannitol)
Locus tag: Atu3170
Name: null Funciton: ABC transporter, nucleotide binding/ATPase protein (sorbitol/mannitol) |
||||
| fruK-agaZ-Atu3168-Atu3169-Atu3170 | -285 | 5.2 | AACAATACATGCGTAAATTT | Atu3166 |
| -98 | 6 | ATATTGACGCGCGTAAACTT | ||