Orthologous regulated operons containing smoE gene
Regulog: | SmoR - Rhizobiales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Sorbitol utilization; Mannitol utilization |
Effector: | Mannitol; Sorbitol |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Agrobacterium tumefaciens str. C58 (Cereon) | ||||
Position: -114
Score: 5.20743 Sequence: AAATTTACGCATGTATTGTT
Locus tag: Atu3165
Name: smoE Funciton: ABC transporter, substrate binding protein (sorbitol/mannitol)
Locus tag: Atu3164
Name: smoS Funciton: sorbitol dehydrogenase
Locus tag: Atu3163
Name: Atu3163 Funciton: zinc-binding dehydrogenase
Locus tag: Atu3162
Name: smoR Funciton: Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
||||
smoE-smoS-Atu3163-smoR | -114 | 5.2 | AAATTTACGCATGTATTGTT | Atu3165 |