Orthologous regulated operons containing SMb21376 gene
| Regulog: | SmoR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sorbitol utilization; Mannitol utilization |
| Effector: | Mannitol; Sorbitol |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Sinorhizobium meliloti 1021 | ||||
|
Position: -114
Score: 5.48668 Sequence: AAATTGACGCGCGGTAAGTT
Locus tag: SMb21377
Name: null Funciton: Ribose/xylose/arabinose/galactoside ABC-type transport systems, substrate-binding component
Locus tag: SMb21376
Name: null Funciton: Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 (EC 3.6.3.17)
Locus tag: SMb21375
Name: null Funciton: Ribose/xylose/arabinose/galactoside ABC-type transport systems, permease components
Locus tag: SMb21374
Name: fruK Funciton: Fructokinase (EC 2.7.1.4)
Locus tag: SMb21373
Name: agaZ Funciton: Tagatose 6-phosphate kinase
Locus tag: SMb21372
Name: smoR Funciton: Transcriptional regulator for sorbitol and mannitol utilization, LacI family |
||||
| SMb21377-SMb21376-SMb21375-fruK-agaZ-smoR | -114 | 5.5 | AAATTGACGCGCGGTAAGTT | SMb21377 |