Orthologous regulated operons containing BL0611 gene
Regulog: | BL0610 - Bifidobacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Carbohydrate metabolism |
Effector: | |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bifidobacterium longum NCC2705 | ||||
Position: -48
Score: 7.14005 Sequence: GAACCTTATCGATAAGAATC
Locus tag: BL0611
Name: null Funciton: hypothetical protein |
||||
BL0611 | -48 | 7.1 | GAACCTTATCGATAAGAATC | BL0611 |