Orthologous regulated operons containing BL0610 gene
Regulog: | BL0610 - Bifidobacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Carbohydrate metabolism |
Effector: | |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bifidobacterium longum NCC2705 | ||||
Position: -33
Score: 7.14005 Sequence: GATTCTTATCGATAAGGTTC
Locus tag: BL0610
Name: null Funciton: Transcriptional regulator, LacI family |
||||
BL0610 | -33 | 7.1 | GATTCTTATCGATAAGGTTC | BL0610 |