Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Blon_2413 gene

Properties
Regulog: GosR2 - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Galactooligosaccharide utilization
Effector:
Phylum: Actinobacteria
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -99
Score: 6.28081
Sequence: AGATTAAATCGGTTTAAAAC
Locus tag: Blon_2414
Name: Blon_2414
Funciton: Galactooligosaccharide ABC transporter, substrate-binding component
Locus tag: Blon_2413
Name: Blon_2413
Funciton: Galactooligosaccharide ABC transporter, permease component
Locus tag: Blon_2412
Name: Blon_2412
Funciton: Galactooligosaccharide ABC transporter, permease component
Locus tag: Blon_2411
Name: xylD
Funciton: endo-1,4-beta-xylanase
Blon_2414-Blon_2413-Blon_2412-xylD -99 6.3 AGATTAAATCGGTTTAAAAC Blon_2414