Orthologous regulated operons containing Blon_2414 gene

Properties
Regulog:	GosR2 - Bifidobacteriaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Galactooligosaccharide utilization
Effector:
Phylum:	Actinobacteria

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -99 Score: 6.28081 Sequence: AGATTAAATCGGTTTAAAAC Locus tag: Blon_2414 Name: Blon_2414 Funciton: Galactooligosaccharide ABC transporter, substrate-binding component Locus tag: Blon_2413 Name: Blon_2413 Funciton: Galactooligosaccharide ABC transporter, permease component Locus tag: Blon_2412 Name: Blon_2412 Funciton: Galactooligosaccharide ABC transporter, permease component Locus tag: Blon_2411 Name: xylD Funciton: endo-1,4-beta-xylanase
Blon_2414-Blon_2413-Blon_2412-xylD	-99	6.3	AGATTAAATCGGTTTAAAAC	Blon_2414

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --